ggKbase home page

PLM1_100_b1_sep16_scaffold_7546_1

Organism: PLM1_100_b1_sep16_Actinobacteria_69_15

near complete RP 47 / 55 MC: 3 BSCG 49 / 51 MC: 2 ASCG 12 / 38
Location: comp(2..124)

Top 3 Functional Annotations

Value Algorithm Source
LuxR family transcriptional regulator Tax=Actinoplanes globisporus RepID=UPI000378E6F3 similarity UNIREF
DB: UNIREF100
  • Identity: 73.2
  • Coverage: 41.0
  • Bit_score: 63
  • Evalue 3.80e-08
LuxR family transcriptional regulator similarity KEGG
DB: KEGG
  • Identity: 73.2
  • Coverage: 41.0
  • Bit_score: 62
  • Evalue 2.40e-08
Bacterial regulatory s, luxR family protein {ECO:0000313|EMBL:AFR05717.1}; species="Bacteria; Actinobacteria; Streptosporangiales; Nocardiopsaceae; Nocardiopsis.;" source="Nocardiopsis alba (strain ATCC BAA-2165 / BE74).;" similarity UNIPROT
DB: UniProtKB
  • Identity: 70.7
  • Coverage: 41.0
  • Bit_score: 62
  • Evalue 1.20e-07

Lists

This feature is not on any list.

Notes

This feature has no notes.

Taxonomy

Nocardiopsis alba → Nocardiopsis → Streptosporangiales → Actinobacteria → Actinobacteria → Bacteria

Sequences

DNA sequence
Length: 123
GTGAGCATCAAGGTTCTCCTGGCCGACGACCAGGAGCTCGTCCGCACCGGATTCCGGAAGATCCTCGAGTCCGAGGACGATCTGGAGGTTGTCGGCGAGGCGGCGAACGGGCGGGAGGCCGTC
PROTEIN sequence
Length: 41
VSIKVLLADDQELVRTGFRKILESEDDLEVVGEAANGREAV