ggKbase home page

PLM4_90_b1_sep16_scaffold_1166_10

Organism: PLM4_90_b1_sep16_Bathyarchaeota_47_9

near complete RP 35 / 55 MC: 6 BSCG 19 / 51 MC: 2 ASCG 33 / 38 MC: 4
Location: 8264..8323

Top 3 Functional Annotations

There are no annotations for this feature.

Lists

This feature is not on any list.

Notes

This feature has no notes.

Taxonomy

No taxonomy information

Sequences

DNA sequence
Length: 60
ATGTCTAGGAAGATTCCATCGAAGGACGAAGCACTTGAAGCCTTAGACTTTATCGTCAAT
PROTEIN sequence
Length: 20
MSRKIPSKDEALEALDFIVN