ggKbase home page

ERMLT700_curated_scaffold_7369_trna_1

Organism: ERMLT700_Acidobacteria_63_19_curated

near complete RP 49 / 55 MC: 1 BSCG 49 / 51 MC: 3 ASCG 12 / 38
Location: 1611..1684

Top 3 Functional Annotations

Value Algorithm Source
transferRNA Arg similarity in-house
  • Identity: 0.0
  • Coverage: 0.0
  • Bit_score: 0
  • Evalue 0.0

Lists

This feature is not on any list.

Notes

This feature has no notes.

Taxonomy

No taxonomy information

Sequences

DNA sequence
Length: 74
GTCCCCGTAGCTCAGCTGGATAGAGCGCGCGCCTCCTAAGCGCGAGGCCGACGGTTCAAATCCGTCCGGGGACG