ggKbase home page

CARFMA_99_1

Organism: Finegoldia magna

partial RP 23 / 55 MC: 4 BSCG 19 / 51 MC: 1 ASCG 0 / 38
Location: comp(3..83)

Top 3 Functional Annotations

Value Algorithm Source
CATION-TRANSPORTING ATPASE (db=HMMPanther db_id=PTHR11939 from=1 to=26 evalue=1.7e-11 interpro_id=IPR001757 interpro_description=ATPase, P-type, K/Mg/Cd/Cu/Zn/Na/Ca/Na/H-transporter GO=Molecular Function: ATP binding (GO:0005524), Biological Process: ATP biosynthetic process (GO:0006754), Molecular Function: ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism (GO:0015662), Cellular Component: membrane (GO:0016020)) iprscan interpro
DB: HMMPanther
  • Identity: null
  • Coverage: null
  • Bit_score: null
  • Evalue 1.70e-11
POTASSIUM-TRANSPORTING ATPASE B CHAIN (POTASSIUM- TRANSLOCATING ATPASE B CHAIN) (db=HMMPanther db_id=PTHR11939:SF27 from=1 to=26 evalue=1.7e-11 interpro_id=IPR006391 interpro_description=Potassium-transporting ATPase, B chain GO=Molecular Function: magnesium ion binding (GO:0000287), Molecular Function: ATP binding (GO:0005524), Biological Process: potassium ion transport (GO:0006813), Molecular Function: potassium-transporting ATPase activity (GO:0008556), Cellular Component: integral to membrane (GO:00160 iprscan interpro
DB: HMMPanther
  • Identity: null
  • Coverage: null
  • Bit_score: null
  • Evalue 1.70e-11
HAD-like (db=superfamily db_id=SSF56784 from=1 to=25 evalue=3.9e-07) iprscan interpro
DB: superfamily
  • Identity: null
  • Coverage: null
  • Bit_score: null
  • Evalue 3.90e-07

Lists

This feature is not on any list.

Notes

This feature has no notes.

Taxonomy

Finegoldia magna → Finegoldia → Clostridiales → Clostridia → Firmicutes → Bacteria

Sequences

DNA sequence
Length: 81
ATGACGGGAGATGGCACAAATGATGCTCCAGCATTGGCTCAAGCAGATGTTGGGATAGCAATGAATAGTGGAACAACTTCT
PROTEIN sequence
Length: 27
MTGDGTNDAPALAQADVGIAMNSGTTS