ggKbase home page

cn_combo_scaffold_4885_8

Organism: CN-SCN_Rhodospirillales_16x

near complete RP 42 / 55 BSCG 41 / 51 ASCG 9 / 38
Location: comp(7282..7542)

Top 3 Functional Annotations

Value Algorithm Source
Glutaredoxin n=1 Tax=Sphingobium lactosutens DS20 RepID=T0HJU7_9SPHN similarity UNIREF
DB: UNIREF100
  • Identity: 65.9
  • Coverage: 85.0
  • Bit_score: 115
  • Evalue 3.10e-23
glutaredoxin; K03676 glutaredoxin 3 Tax=RIFCSPHIGHO2_12_FULL_Alphaproteobacteria_66_14_curated similarity UNIPROT
DB: UniProtKB
  • Identity: 86.0
  • Coverage: 86.0
  • Bit_score: 158
  • Evalue 3.40e-36
grxC; glutaredoxin similarity KEGG
DB: KEGG
  • Identity: 66.7
  • Coverage: 84.0
  • Bit_score: 113
  • Evalue 4.30e-23

Lists

This feature is not on any list.

Notes

This feature has no notes.

Taxonomy

R_Alphaproteobacteria_66_14 → Rhodospirillales → Alphaproteobacteria → Proteobacteria → Bacteria

Sequences

DNA sequence
Length: 261
ATGGCCAAGATCGAAATCTACACCACGCCGTTCTGCGGCTACTGCGCCCGGGCAAAAGGCTTGCTCGACAAGAAAGGTGCGGCTTACGAAGAAATGGACGTGATGATGGACGACAAGAAGCGCAGCGAGATGCGCGAACGGTCCCGGCGCACGACCGTGCCGCAGATCTTCATCAACGGCGAACATGTCGGCGGTTCCGACGAACTCGCCGCTCTCGAGAGCGCGGGCAAGCTCGACGCGCTGCTCGCCCAGCCGGGCTGA
PROTEIN sequence
Length: 87
MAKIEIYTTPFCGYCARAKGLLDKKGAAYEEMDVMMDDKKRSEMRERSRRTTVPQIFINGEHVGGSDELAALESAGKLDALLAQPG*